Stem-loop sequence bta-mir-2384

AccessionMI0011421 (change log)
Previous IDsbta-mir-2384-1
DescriptionBos taurus miR-2384 stem-loop
Literature search

1 open access papers mention bta-mir-2384
(1 sentences)

Stem-loop
   -ug   ucguaaaacu   c      ga       --   g 
5'    ucc          gua uggaag  uggaugg  cag a
      |||          ||| ||||||  |||||||  |||  
3'    agg          cau accuuc  acuugcc  guu a
   aca   -------uuu   a      -g       au   c 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 18823097-18823169 [-]
intergenic
Database links

Mature sequence bta-miR-2384

Accession MIMAT0011933
Sequence

12 - 

aacuguacuggaaggauggaugg

 - 34

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental;

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).