Stem-loop sequence bta-mir-2387

AccessionMI0011427 (change log)
DescriptionBos taurus miR-2387 stem-loop
Gene family MIPF0001986; mir-2387
Literature search

2 open access papers mention bta-mir-2387
(2 sentences)

Stem-loop
       u       c  -g      u  c       c  gg 
5' agcg ggagggc ug  aaggcc gg uuugcag gu  a
   |||| ||||||| ||  |||||| || ||||||| ||  c
3' ucgc cuucccg ac  uuccgg cc agacguc ca  u
       -       a  gg      c  -       c  gg 
Get sequence
Deep sequencing
224 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 33609132-33609209 [-]
sense
ENSBTAT00000008161 ; GTF2IRD1-201; intron 21
Database links

Mature sequence bta-miR-2387

Accession MIMAT0011939
Sequence

14 - 

uggaaggccuggcuuugcagcg

 - 35

Get sequence
Deep sequencing203 reads, 29 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).