Stem-loop sequence bta-mir-2396

AccessionMI0011436 (change log)
DescriptionBos taurus miR-2396 stem-loop
Literature search

1 open access papers mention bta-mir-2396
(1 sentences)

Stem-loop
       g         g       ac  -      a 
5' gaug ucaucgaga cccagug  ug ggagua c
   |||| ||||||||| |||||||  || ||||||  
3' uuac gguaguucu gggucac  ac cuucgu a
       g         g       gu  u      g 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 42678160-42678228 [+]
sense
ENSBTAT00000014288 ; TACC2-202; intron 15
ENSBTAT00000061158 ; TACC2-201; intron 21
Database links

Mature sequence bta-miR-2396

Accession MIMAT0011949
Sequence

43 - 

ucaugcacuggggucuugaugg

 - 64

Get sequence
Deep sequencing18 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).