Stem-loop sequence bta-mir-2399

AccessionMI0011440 (change log)
DescriptionBos taurus miR-2399 stem-loop
Literature search

2 open access papers mention bta-mir-2399
(2 sentences)

Stem-loop
   guaaucc               c           ug u 
5'        ucacacuuucuguag uguuggaacua  g g
          ||||||||||||||| |||||||||||  |  
3'        agugugaaagacauc acaaucuuggu  u c
   cacuaaa               a           gu a 
Get sequence
Deep sequencing
98 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr27: 25852073-25852150 [+]
sense
ENSBTAT00000047899 ; RBPMS-201; intron 1
Database links

Mature sequence bta-miR-2399-5p

Accession MIMAT0011954
Previous IDsbta-miR-2399
Sequence

13 - 

cuuucuguagcuguuggaacua

 - 34

Get sequence
Deep sequencing92 reads, 47 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2399-3p

Accession MIMAT0011955
Previous IDsbta-miR-2399*
Sequence

48 - 

uucuaacaacuacagaaagugu

 - 69

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).