Stem-loop sequence bta-mir-2412

AccessionMI0011457 (change log)
DescriptionBos taurus miR-2412 stem-loop
Literature search

2 open access papers mention bta-mir-2412
(8 sentences)

Stem-loop
       g   cauu   gg      -    ---g  --      a 
5' uaau agu    cuu  ggcugg gugg    ga  gagggc a
   |||| |||    |||  |||||| ||||    ||  ||||||  
3' guug uca    gag  ccgacc cacc    uu  cuuucg c
       a   ---c   -a      g    aaaa  aa      u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 19031709-19031786 [-]
intergenic
Database links

Mature sequence bta-miR-2412

Accession MIMAT0011974
Sequence

14 - 

uuggggcuggguggggagaggg

 - 35

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).