Stem-loop sequence bta-mir-2424

AccessionMI0011474 (change log)
Previous IDsbta-mir-2424-1
DescriptionBos taurus miR-2424 stem-loop
Literature search

1 open access papers mention bta-mir-2424
(1 sentences)

Stem-loop
   u    aggacu     ugugcugug    cu    ga  a 
5'  ccag      uagcc         gcca  gaga  ug a
    ||||      |||||         ||||  ||||  || a
3'  gguc      gucgg         uggu  uucu  ac c
   g    guaaac     -uagucuaa    --    ag  a 
Get sequence
Deep sequencing
238 reads, 0 reads per million, 62 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 104548335-104548414 [-]
sense
ENSBTAT00000062286 ; snoU85-201; exon 1
ENSBTAT00000019603 ; NCAPD2-201; intron 4
Database links

Mature sequence bta-miR-2424

Accession MIMAT0011993
Sequence

46 - 

agaucuuugguaaucugauggcu

 - 68

Get sequence
Deep sequencing466 reads, 61 experiments
Evidence experimental;

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).