Stem-loop sequence bta-mir-2428

AccessionMI0011478 (change log)
DescriptionBos taurus miR-2428 stem-loop
Literature search

1 open access papers mention bta-mir-2428
(1 sentences)

Stem-loop
     c  acau        -     c  a    ag 
5' gc ca    ggcuggag ugcgg gg ggug  c
   || ||    |||||||| ||||| || ||||  c
3' cg gu    ccgaccuc acguc cc ccgc  g
     a  -ccu        g     -  -    ca 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 42062305-42062369 [+]
intergenic
Database links

Mature sequence bta-miR-2428

Accession MIMAT0011998
Sequence

9 - 

uggcuggagugcggcggaggu

 - 29

Get sequence
Deep sequencing13 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).