Stem-loop sequence bta-mir-2433

AccessionMI0011484 (change log)
DescriptionBos taurus miR-2433 stem-loop
Literature search

1 open access papers mention bta-mir-2433
(1 sentences)

Stem-loop
       g    g     gc   g    c    aug    ag 
5' ccag aggg ugggg  gcu caga acgg   guuc  a
   |||| |||| |||||  ||| |||| ||||   ||||   
3' gguc uccc acucc  cgg gucu ugcc   caag  a
       a    g     ua   -    u    --a    ag 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 57577222-57577298 [-]
antisense
ENSBTAT00000015626 ; ANKRD52-201; intron 2
Database links

Mature sequence bta-miR-2433

Accession MIMAT0012005
Sequence

11 - 

ugggggcgcugcagacacggaug

 - 33

Get sequence
Deep sequencing43 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).