Stem-loop sequence bta-mir-2443

AccessionMI0011496 (change log)
DescriptionBos taurus miR-2443 stem-loop
Literature search

1 open access papers mention bta-mir-2443
(1 sentences)

Stem-loop
          uu     c   a   ua    --gu   ca 
5' gugaggg  gaggg agg ccg  ugag    guc  a
   |||||||  ||||| ||| |||  ||||    |||  g
3' cacuccc  cuccc ucc ggc  acuc    cgg  g
          --     u   c   cg    accu   aa 
Get sequence
Deep sequencing
1444 reads, 4.88 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 117458061-117458133 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2443
bta-let-7a-3chr5: 117457806-117457879 [+]
bta-mir-2443chr5: 117458061-117458133 [+]
bta-let-7bchr5: 117458606-117458686 [+]
bta-mir-3596chr5: 117458609-117458691 [-]
Database links

Mature sequence bta-miR-2443

Accession MIMAT0012018
Sequence

9 - 

ugagggcaggaccguaugaggugu

 - 32

Get sequence
Deep sequencing1443 reads, 41 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).