Stem-loop sequence bta-mir-2450c

AccessionMI0011504 (change log)
DescriptionBos taurus miR-2450c stem-loop
Gene family MIPF0000758; mir-2450
Literature search

1 open access papers mention bta-mir-2450c
(1 sentences)

Stem-loop
                  auu     acacucgguauag 
5' agaggcgcaugugcc   ucugc             a
   |||||||||||||||   |||||             u
3' uuuccgugugcgcgg   agaug             g
                  ---     acugcacacgcgc 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 108174504-108174575 [-]
sense
ENSBTAT00000001972 ; HTT-201; intron 21
Clustered miRNAs
< 10kb from bta-mir-2450c
bta-mir-2450cchr6: 108174504-108174575 [-]
bta-mir-2450dchr6: 108173970-108174042 [-]
bta-mir-2450bchr6: 108173861-108173933 [-]
bta-mir-2450achr6: 108173591-108173663 [-]
Database links

Mature sequence bta-miR-2450c

Accession MIMAT0012028
Sequence

46 - 

cacgucaguagaggcgcgugug

 - 67

Get sequence
Deep sequencing58 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).