Stem-loop sequence bta-mir-2450a

AccessionMI0011506 (change log)
DescriptionBos taurus miR-2450a stem-loop
Gene family MIPF0000758; mir-2450
Literature search

1 open access papers mention bta-mir-2450a
(1 sentences)

Stem-loop
              ug     u    a  cu  -  aua 
5' agaggcgcgug  ccuuu cugc ca  ug gu   g
   |||||||||||  ||||| |||| ||  || ||    
3' uuuccguguac  ggaga gacg gu  ac cg   a
              gu     u    g  ac  a  cuc 
Get sequence
Deep sequencing
679 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 108173591-108173663 [-]
sense
ENSBTAT00000001972 ; HTT-201; intron 21
Clustered miRNAs
< 10kb from bta-mir-2450a
bta-mir-2450cchr6: 108174504-108174575 [-]
bta-mir-2450dchr6: 108173970-108174042 [-]
bta-mir-2450bchr6: 108173861-108173933 [-]
bta-mir-2450achr6: 108173591-108173663 [-]
Database links

Mature sequence bta-miR-2450a

Accession MIMAT0012030
Sequence

48 - 

ugggcaguagaggugcaugug

 - 68

Get sequence
Deep sequencing678 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).