Stem-loop sequence bta-mir-2454

AccessionMI0011511 (change log)
DescriptionBos taurus miR-2454 stem-loop
Literature search

2 open access papers mention bta-mir-2454
(5 sentences)

Stem-loop
        u acu      u     gc        --u g 
5' cccug g   gggggc gccag  aggaggcg   g c
   ||||| |   |||||| |||||  ||||||||   |  
3' gggac c   cucucg cgguc  uccucugu   c u
        c cuc      c     --        ggu c 
Get sequence
Deep sequencing
124 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 15988170-15988241 [-]
sense
ENSBTAT00000003549 ; DNMT1-201; intron 33
Database links

Mature sequence bta-miR-2454-5p

Accession MIMAT0012035
Previous IDsbta-miR-2454
Sequence

9 - 

cugggggcugccaggcaggaggc

 - 31

Get sequence
Deep sequencing54 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2454-3p

Accession MIMAT0012036
Previous IDsbta-miR-2454*
Sequence

45 - 

ucuccucuggccgcucuccu

 - 64

Get sequence
Deep sequencing70 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).