![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-339b |
|||||
Accession | MI0011513 (change log) | ||||
Description | Bos taurus miR-339b stem-loop | ||||
Literature search |
5 open access papers mention bta-mir-339b | ||||
Stem-loop |
ug c - gg g 5' uccc uccu caggag cucca ucu g |||| |||| |||||| ||||| ||| g 3' aggg agga gucuuu ggggu ggg g -- c a gu u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-339b |
|
Accession | MIMAT0012038 |
Sequence |
1 - ucccuguccuccaggagcuc - 20 |
Deep sequencing | 14733 reads, 77 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:19633723
"Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"
PLoS One. 4:e6349(2009).
|