Stem-loop sequence bta-mir-339b

Accession

MI0011513 (change log)

Description

Bos taurus miR-339b stem-loop

Literature search

5 open access papers mention bta-mir-339b
(5 sentences)

Stem-loop

       ug    c      -     gg   g 
5' uccc  uccu caggag cucca  ucu g
   ||||  |||| |||||| |||||  ||| g
3' aggg  agga gucuuu ggggu  ggg g
       --    c      a     gu   u 

Deep sequencing

14736 reads, 227 reads per million, 77 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr7: 18457361-18457418 [-]
• Overlapping transcripts:

  sense

  ENSBTAT00000010081 ; MYO1F-201; intron 1

Database links

• EntrezGene:MIR339B
• RNAcentral:URS000075B04E_9913
• miRBase Tracker:MI0011513

Mature sequence bta-miR-339b

• Accession: MIMAT0012038
• Sequence: 1 - ucccuguccuccaggagcuc - 20
• Deep sequencing: 14733 reads, 77 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:bta-miR-339b

References

1. PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).