bta-mir-2484 is a microRNA that has been identified as differentially expressed in the peripheral blood mononuclear cells (PBMCs) of buffaloes infected with Mycobacterium paratuberculosis (M. paratuberculosis) [PMC7242893]. This microRNA was among the top three up-regulated miRNAs in infected buffaloes, with a significant fold-change, indicating its potential role in the host response to infection [PMC5766512]. Additionally, bta-mir-2484 was also differentially expressed in mammary glands infected with Staphylococcus aureus, suggesting a broader role in immune response to bacterial infections [PMC6600136]. The up-regulation of bta-mir-2484 was confirmed in monocyte-derived macrophages (MDMs) infected with M. paratuberculosis as well [PMC6600136]. Interestingly, bta-mir-2484 appears to be nearly species-specific and lacks homology with human or mouse miRNAs, highlighting its potential as a biomarker for bovine-specific infections [PMC6600136]. The expression of bta-mir-2484 has been validated through RT-qPCR following initial RNA-Seq results to ensure the reliability of data regarding its expression levels [PMC6600136]. Furthermore, it is implicated in the regulation of CYP7A1 along with other miRNAs and lncRNAs particularly within the context of dietary influences such as grass feeding [PMC7969984].
c -a ug -a aa uuau uga aaugua caggguuauuaua uua a |||| ||| |||||| ||||||||||||| ||| agua acu uUACGU GUUUCAGUAGUAU AGu a c ag UA CG gg
Accession | MIMAT0012077 |
Description | Bos taurus bta-miR-2484 mature miRNA |
Sequence | 42 - GAGCUAUGAUGACUUUGAUUGCAU - 65 |
Evidence |
experimental
Illumina [1] |
|