Stem-loop sequence xtr-mir-2184

AccessionMI0011553 (change log)
DescriptionXenopus tropicalis miR-2184 stem-loop
Stem-loop
        g    g  a         au         u   au 
5' cuugc ucuc ga caguaagag  uaugugcug guu  c
   ||||| |||| || |||||||||  ||||||||| |||  a
3' ggacg agag cu gucauuuuc  guacacggc cga  g
        g    a  c         cg         -   cg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 27689426-27689507 [-]
intergenic
Database links

Mature sequence xtr-miR-2184

Accession MIMAT0012192
Sequence

13 - 

aacaguaagagauuaugugcug

 - 34

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19628731 "Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis" Armisen J, Gilchrist MJ, Wilczynska A, Standart N, Miska EA Genome Res. 19:1766-1775(2009).