Stem-loop sequence xtr-mir-2188

AccessionMI0011554
DescriptionXenopus tropicalis miR-2188 stem-loop
Gene family MIPF0000812; mir-2188
Stem-loop
   --g   g       a     ca   u     g    g gau 
5'    ggc uguggga agguc  gcc cauau uccu u   c
      ||| ||||||| |||||  ||| ||||| |||| |    
3'    ccg acacccu uccag  ugg guaua aggg g   c
   gug   g       g     ac   u     g    g agu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172670.1: 1746728-1746809 [-]
sense
ENSXETT00000036632 ; ank1-202; intron 2

Mature sequence xtr-miR-2188

Accession MIMAT0012193
Sequence

13 - 

aagguccagccucauauguccu

 - 34

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19628731 "Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis" Armisen J, Gilchrist MJ, Wilczynska A, Standart N, Miska EA Genome Res. 19:1766-1775(2009).