Stem-loop sequence hbv-mir-B20

AccessionMI0011557 (change log)
DescriptionHerpes B virus miR-B20 stem-loop
Stem-loop
     -     g   g         a   ug  g       --   cg 
5' cg ccggc gcg ccgagagug ggg  gc agcgcgu  gga  c
   || ||||| ||| ||||||||| |||  || |||||||  |||   
3' gc ggccg cgc ggcucucgc ccc  ug ucgugca  ccu  a
     a     g   g         g   gu  g       gc   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Refseq:NC_004812) Overlapping transcripts
NC_004812: 298-386 [-]
intergenic
NC_004812: 125472-125560 [+]
intergenic
Clustered miRNAs
< 10kb from hbv-mir-B20
hbv-mir-B20NC_004812: 125472-125560 [+]
hbv-mir-B26NC_004812: 125347-125404 [+]
hbv-mir-B19NC_004812: 125195-125258 [+]
hbv-mir-B22NC_004812: 118383-118456 [+]
hbv-mir-B14RCNC_004812: 118383-118455 [-]
hbv-mir-B14RCNC_004812: 7403-7475 [+]
hbv-mir-B22NC_004812: 7402-7475 [-]
hbv-mir-B19NC_004812: 600-663 [-]
hbv-mir-B26NC_004812: 454-511 [-]
hbv-mir-B20NC_004812: 298-386 [-]
Database links

Mature sequence hbv-miR-B20-5p

Accession MIMAT0012172
Sequence

17 - 

gagugaggguggcgagcgcgu

 - 37

Get sequence
Evidence experimental; Northern [1], Illumina [2]

Mature sequence hbv-miR-B20-3p

Accession MIMAT0031158
Sequence

54 - 

gugcugguugcccgcgcucucg

 - 75

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19144716 "Discovery of herpes B virus-encoded microRNAs" Besecker MI, Harden ME, Li G, Wang XJ, Griffiths A J Virol. 83:3413-3416(2009).
2
PMID:21543500 "Identification and expression analysis of herpes B virus-encoded small RNAs" Amen MA, Griffiths A J Virol. 85:7296-7311(2011).