Stem-loop sequence bdi-MIR1122

AccessionMI0011568 (change log)
DescriptionBrachypodium distachyon miR1122 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

2 open access papers mention bdi-MIR1122
(5 sentences)

Stem-loop
   ucguccauguauccauauuucauugccgaaauauuacauguguaucuagacguuuuuuacacauagauaca  c  a    ga        agacgaguaauagagaucggauggaguacaa 
5'                                                                        uc gu uuug  caaauuug                               u
                                                                          || || ||||  ||||||||                                
3'                                                                        ag ca agac  guuuaaac                               u
   -----------------------------------------------------------------gcacca  u  -    ac        acauacaccacuggucuauucuuccccuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25218612-25218791 [-]
intergenic
Database links

Mature sequence bdi-miR1122

Accession MIMAT0012183
Sequence

64 - 

uagauacauccguauuugga

 - 83

Get sequence
Evidence by similarity; MI0006184

References

1