![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR166a |
|||||
Accession | MI0011570 (change log) | ||||
Previous IDs | bdi-MIR166 | ||||
Description | Brachypodium distachyon miR166a stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
2 open access papers mention bdi-MIR166a | ||||
Stem-loop |
uuuu -- a c g aaga a c gg 5' caugguu gucg ggggaauga gcc ggucugaaaga agggggc cgc g a ||||||| |||| ||||||||| ||| ||||||||||| ||||||| ||| | a 3' guaccag cagu ccccuuacu cgg ccaggcuuucu ucccuug gcg c u ---g cu a u a -cga - a ag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR166a-5p |
|
Accession | MIMAT0026922 |
Sequence |
20 - gaaugacgccgggucugaaag - 40 |
Evidence | experimental; Illumina [3] |
Mature sequence bdi-miR166a-3p |
|
Accession | MIMAT0012185 |
Previous IDs | bdi-miR166 |
Sequence |
85 - ucggaccaggcuucauucccc - 105 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:19585143
"Conserved microRNAs and their targets in model grass species Brachypodium distachyon"
Planta. 230:659-669(2009).
|
2 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
3 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|