Stem-loop sequence bdi-MIR166a

AccessionMI0011570 (change log)
Previous IDsbdi-MIR166
DescriptionBrachypodium distachyon miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention bdi-MIR166a
(21 sentences)

Stem-loop
   uuuu       --    a         c   g           aaga       a   c gg 
5'     caugguu  gucg ggggaauga gcc ggucugaaaga    agggggc cgc g  a
       |||||||  |||| ||||||||| ||| |||||||||||    ||||||| ||| |  a
3'     guaccag  cagu ccccuuacu cgg ccaggcuuucu    ucccuug gcg c  u
   ---g       cu    a         u   a           -cga       -   a ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 6574374-6574493 [+]
intergenic
Database links

Mature sequence bdi-miR166a-5p

Accession MIMAT0026922
Sequence

20 - 

gaaugacgccgggucugaaag

 - 40

Get sequence
Evidence experimental; Illumina [3]

Mature sequence bdi-miR166a-3p

Accession MIMAT0012185
Previous IDsbdi-miR166
Sequence

85 - 

ucggaccaggcuucauucccc

 - 105

Get sequence
Evidence experimental; Illumina [3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).