Stem-loop sequence bdi-MIR166a

Accession

MI0011570 (change log)

Previous IDs

bdi-MIR166

Description

Brachypodium distachyon miR166a stem-loop

Gene family

MIPF0000004; MIR166

Literature search

2 open access papers mention bdi-MIR166a
(21 sentences)

Stem-loop

   uuuu       --    a         c   g           aaga       a   c gg 
5'     caugguu  gucg ggggaauga gcc ggucugaaaga    agggggc cgc g  a
       |||||||  |||| ||||||||| ||| |||||||||||    ||||||| ||| |  a
3'     guaccag  cagu ccccuuacu cgg ccaggcuuucu    ucccuug gcg c  u
   ---g       cu    a         u   a           -cga       -   a ag 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Bd21; GCA_000005505.1): 1: 6574374-6574493 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0011570

Mature sequence bdi-miR166a-5p

• Accession: MIMAT0026922
• Sequence: 20 - gaaugacgccgggucugaaag - 40
• Evidence: experimental; Illumina [3]

Mature sequence bdi-miR166a-3p

• Accession: MIMAT0012185
• Previous IDs: bdi-miR166
• Sequence: 85 - ucggaccaggcuucauucccc - 105
• Evidence: experimental; Illumina [3]

References

1. PMID:19585143 "Conserved microRNAs and their targets in model grass species Brachypodium distachyon" Unver T, Budak H Planta. 230:659-669(2009).
2. PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3. PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).