Stem-loop sequence bdi-MIR169b

AccessionMI0011574 (change log)
DescriptionBrachypodium distachyon miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

3 open access papers mention bdi-MIR169b
(27 sentences)

Stem-loop
   gagauagaga u    --ug    caa    ga uu      uau         -cg  u 
5'           g ggaa    uagc   ggau  c  gccggg   gugcaugua   cu c
             | ||||    ||||   ||||  |  ||||||   |||||||||   ||  
3'           c ccuu    gucg   ccua  g  uggucc   uacguauau   gg a
   --------gg -    uaua    -ua    -a uc      --c         uaa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 27159120-27159225 [-]
intergenic
Database links

Mature sequence bdi-miR169b

Accession MIMAT0012189
Sequence

19 - 

uagccaaggaugacuugccgg

 - 39

Get sequence
Evidence experimental; Illumina [3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).