Stem-loop sequence dme-mir-2491

AccessionMI0011580 (change log)
DescriptionDrosophila melanogaster miR-2491 stem-loop
Literature search

1 open access papers mention dme-mir-2491
(5 sentences)

Stem-loop
   -----cgc   c   uuu    c        cu    a         uuccauguugcuacugcggccaauugu 
5'         gaa cac   gugc gcuguugc  uugc guugcuguu                           u
           ||| |||   |||| ||||||||  |||| |||||||||                            
3'         cuu gug   cacg cgaugacg  aacg cgacgacaa                           g
   agcuuuca   a   -cu    a        uc    a         caacuacaacaacuacaacgacuacgc 
Get sequence
Deep sequencing
224 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 22833440-22833583 [-]
sense
FBtr0333179 ; fog-RC; intron 1
FBtr0333180 ; fog-RD; intron 1
FBtr0333182 ; fog-RF; intron 2
FBtr0077342 ; fog-RA; intron 2
FBtr0100538 ; fog-RB; intron 3
FBtr0333181 ; fog-RE; intron 3
antisense
FBtr0333178 ; CG42346-RD; intron 1
FBtr0333177 ; CG42346-RC; intron 1
Database links

Mature sequence dme-miR-2491-5p

Accession MIMAT0012198
Previous IDsdme-miR-2491
Sequence

18 - 

cgcuguugccuuugcaguugcu

 - 39

Get sequence
Deep sequencing15 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence dme-miR-2491-3p

Accession MIMAT0020912
Sequence

95 - 

caacaacagcagcagcaa

 - 112

Get sequence
Deep sequencing166 reads, 32 experiments
Evidence not experimental

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).