Stem-loop sequence dme-mir-2494

AccessionMI0011583 (change log)
DescriptionDrosophila melanogaster miR-2494 stem-loop
Gene family MIPF0000975; mir-2494
Literature search

2 open access papers mention dme-mir-2494
(2 sentences)

Stem-loop
          -         c -a  --a       c  cag          accuucaaaa 
5' uccaucu uccgaccgg g  uc   guaagug ac   auugggaaua          g
   ||||||| ||||||||| |  ||   ||||||| ||   ||||||||||          c
3' agguggg agguugguc c  ag   cauucac ug   ugacccuuau          u
          u         c cg  gaa       c  uaa          aaauucaacg 
Get sequence
Deep sequencing
800 reads, 17.1 reads per million, 35 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 16618766-16618882 [+]
sense
FBtr0083330 ; CG17560-RA; 3'UTR (exon 4)
Database links

Mature sequence dme-miR-2494-5p

Accession MIMAT0012202
Previous IDsdme-miR-2494*
Sequence

23 - 

guaagugcaccagauugggaa

 - 43

Get sequence
Deep sequencing34 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence dme-miR-2494-3p

Accession MIMAT0012203
Previous IDsdme-miR-2494
Sequence

71 - 

uucccaguaauguccacuuacaag

 - 94

Get sequence
Deep sequencing747 reads, 29 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).