Stem-loop sequence dme-mir-2499

AccessionMI0011588 (change log)
DescriptionDrosophila melanogaster miR-2499 stem-loop
Literature search

1 open access papers mention dme-mir-2499
(1 sentences)

Stem-loop
   uccuugc    g      u    ug   ag c    -g    --a    uu 
5'        ugug gugugg ugcg  cgu  a guca  cgca   ugcc  u
          |||| |||||| ||||  |||  | ||||  ||||   ||||  g
3'        acac cacgcc augc  gca  u cagu  gcgu   gcgg  u
   ------u    a      u    cu   cu a    ag    acg    uu 
Get sequence
Deep sequencing
136 reads, 13.6 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19557008-19557103 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-2499
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
dme-mir-979chrX: 19561837-19561931 [+]
Database links

Mature sequence dme-miR-2499-5p

Accession MIMAT0012212
Previous IDsdme-miR-2499*
Sequence

22 - 

cgugcguagacgucagcgcaaugc

 - 45

Get sequence
Deep sequencing16 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence dme-miR-2499-3p

Accession MIMAT0012213
Previous IDsdme-miR-2499
Sequence

60 - 

augcggaugacauucacguccgua

 - 83

Get sequence
Deep sequencing118 reads, 21 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).