Stem-loop sequence dps-mir-2566a-2

AccessionMI0011712 (change log)
DescriptionDrosophila pseudoobscura miR-2566a-2 stem-loop
Gene family MIPF0000880; mir-2566
Stem-loop
   a   ug     ca     -  a      a c       -  aug 
5'  auu  cauuu  auuua ga acacaa u augugug gu   u
    |||  |||||  ||||| || |||||| | ||||||| ||    
3'  uga  guaaa  uagau cu uguguu a uacauac ca   u
   -   gu     -c     u  c      c a       u  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group4: 3553033-3553118 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2566a-2
dps-mir-25104_group4: 3551345-3551451 [+]
dps-mir-2566a-14_group4: 3552319-3552402 [+]
dps-mir-2511-14_group4: 3552536-3552652 [+]
dps-mir-2567a4_group4: 3552872-3552956 [+]
dps-mir-2566a-24_group4: 3553033-3553118 [+]
dps-mir-2567c4_group4: 3553417-3553521 [+]
dps-mir-2566b4_group4: 3553900-3553982 [+]
dps-mir-2511-24_group4: 3554138-3554224 [+]
dps-mir-2567b4_group4: 3554452-3554536 [+]
Database links

Mature sequence dps-miR-2566a-2-5p

Accession MIMAT0016970
Previous IDsdps-miR-2566a-2*
Sequence

15 - 

uuuagaaacacaaaucaugugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2566a-3p

Accession MIMAT0012395
Previous IDsdps-miR-2566a
Sequence

53 - 

uacauaacuugugucucuuagau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).