Stem-loop sequence mtr-MIR2585a

AccessionMI0011796 (change log)
DescriptionMedicago truncatula miR2585a stem-loop
Gene family MIPF0000820; MIR2585
Stem-loop
   -                                u         auugcaaacuaa       auca                  a  a   ga  a          c          uuauuugaugacgucgcaaucacugccacacaugaaauuccaauuuugcccuuaa 
5'  aauuaggggucguuuaaaaauuggucccugua ucgcuaauc            ccuugca    uuaaucauuuaaaauuuc uc uuu  cc acuuaaucac gccacgucac                                                       g
    |||||||||||||||||||||||||||||||| |||||||||            |||||||    |||||||||||||||||| || |||  || |||||||||| ||||||||||                                                       a
3'  uuaauccccagcaaauuuuuaaccagggacau agcgauuag            ggaacgu    aauuaguaaauuuuaaag ag gag  gg ugaauuagug cggugcggug                                                       a
   g                                u         gaccauuaaaug       aaca                  c  a   ag  g          a          uauuuuaagguuaaaauggggacccaagguuaagaaagaaguuauaaaacaggag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 15526071-15526416 [-]
intergenic
Database links

Mature sequence mtr-miR2585a

Accession MIMAT0013249
Sequence

301 - 

caggauuagcgauuacagggac

 - 322

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).