Stem-loop sequence mtr-MIR2585b

AccessionMI0011797 (change log)
DescriptionMedicago truncatula miR2585b stem-loop
Gene family MIPF0000820; MIR2585
Stem-loop
   u     c                 a    u           u    ac  g c     auca                  a  a   ga  a             cacacauaaaauuccaauucugcccuuaagaagaugacaaaauauugaagaaagaauuggaa 
5'  agggg cguuuaaaaauuggucc ugua ucgcuaauccu gcaa  ua u uugca    uuaaucauuuaaaauuuc uc uuu  cc acuuaaucacugc                                                              a
    ||||| ||||||||||||||||| |||| ||||||||||| ||||  || | |||||    |||||||||||||||||| || |||  || |||||||||||||                                                              c
3'  ucccc gcaaauuuuuaaccagg acau agcgauuagga uguu  gu g gacgu    aauuaguaaauuuuaaag ag gag  gg ugaauuagugacg                                                              c
   -     a                 g    u           c    aa  g u     aaca                  c  g   ag  g             gugcaguucuuaaacuacugcacaguuagugacaauguguacuuuaagguuaaaauggggau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 19585618-19585953 [+]
intergenic
Database links

Mature sequence mtr-miR2585b

Accession MIMAT0013250
Sequence

296 - 

caggauuagcgauuacagggac

 - 317

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).