Stem-loop sequence mtr-MIR2586a

AccessionMI0011798 (change log)
Previous IDsmtr-MIR2586
DescriptionMedicago truncatula miR2586 stem-loop
Stem-loop
   ------------------------------------augacaaccuaugaagcacggauacggacacggac    g   c     a     ----gccg    aacua     u   a 
5'                                                                        accg aca gacac gacac        acac     auaau uga a
                                                                          |||| ||| ||||| |||||        ||||     ||||| ||| a
3'                                                                        uggc ugu cugug cugug        ugug     uauua acu u
   aacaguagauacuucgugccugugaggagccuaauccgcacagggucacagccugugcacagcacaggcua    -   a     g     aacauuaa    --guc     c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 20061144-20061339 [+]
intergenic
Database links

Mature sequence mtr-miR2586a

Accession MIMAT0013251
Previous IDsmtr-miR2586
Sequence

167 - 

cgaggaguguccgugcuucau

 - 187

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).