Stem-loop sequence mtr-MIR2587b

AccessionMI0011800 (change log)
DescriptionMedicago truncatula miR2587b stem-loop
Gene family MIPF0000835; MIR2587
Stem-loop
   a       -u    auu          c          ug aaua   uug 
5'  gguguca  gguc   guugaccguu auaugaaccc  c    aca   c
    |||||||  ||||   |||||||||| ||||||||||  |    |||    
3'  cuacagu  ccag   caacuggcaa uauacuuggg  g    ugu   a
   a       uu    agu          -          gu ----   uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 36871746-36871843 [-]
intergenic
Database links

Mature sequence mtr-miR2587b

Accession MIMAT0013253
Sequence

18 - 

uugaccguucauaugaacccug

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).