Stem-loop sequence mtr-MIR2587d

AccessionMI0011802 (change log)
DescriptionMedicago truncatula miR2587d stem-loop
Gene family MIPF0000835; MIR2587
Stem-loop
   -     ----------      -     au           c          ug  au   au 
5'  uugug          guguca ugguc  uguugaccguu auaugaaccc  ca  agc  u
    |||||          |||||| |||||  ||||||||||| ||||||||||  ||  |||   
3'  aacac          uacagu accag  acaacuggcaa uauacuuggg  gu  ucg  g
   a     agaugaaaaa      u     au           -          gu  gu   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 20166370-20166484 [+]
intergenic
Database links

Mature sequence mtr-miR2587d

Accession MIMAT0013255
Sequence

21 - 

uugaccguucauaugaacccug

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).