Stem-loop sequence mtr-MIR2587f

AccessionMI0011804 (change log)
DescriptionMedicago truncatula miR2587f stem-loop
Gene family MIPF0000835; MIR2587
Stem-loop
   - gg        -u    a            c          ug  au   au 
5'  c  ugguguca  gguc uuguugaccguu auaugaaccc  ca  agc  u
    |  ||||||||  |||| |||||||||||| ||||||||||  ||  |||   
3'  g  acuacagu  ucag gacaacuggcaa uauacuuggg  gu  ucg  g
   a aa        uc    a            -          gu  gu   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 41213267-41213371 [-]
intergenic
Database links

Mature sequence mtr-miR2587f

Accession MIMAT0013257
Sequence

21 - 

uugaccguucauaugaacccug

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).