Stem-loop sequence mtr-MIR2589

AccessionMI0011807 (change log)
DescriptionMedicago truncatula miR2589 stem-loop
Stem-loop
   u    g     a                   a           c           auuuuuu         a      a             a  gu           uuau    uacaaaaauauuaugcacucaguauuagucccugcucaauucaacuauuaaaauuaaacaaauuuga 
5'  guug ugauu agcaaacggugaagcacac uggaugccaca cugacuuuuuu       guuaaauau uuuuua ucccuauaaaauu ag  auuuuaaguuu    uccu                                                                   a
    |||| ||||| ||||||||||||||||||| ||||||||||| |||||||||||       ||||||||| |||||| ||||||||||||| ||  |||||||||||    ||||                                                                    
3'  caac acuaa ucguuugccacuucgugug accuacggugu gacugaaaaaa       caauuuaua aaaaau agggauauuuuaa uc  uaaaauucaaa    agga                                                                   u
   g    a     c                   c           a           aacaacc         c      c             c  ug           --uc    augaauuaaaauuaucaacaaaaucaguaauguuuuuaugauacgugagucauaaucagagacgagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 41740729-41741094 [+]
intergenic
Database links

Mature sequence mtr-miR2589

Accession MIMAT0013260
Sequence

327 - 

ggcauccacgugugcuucaccg

 - 348

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).