Stem-loop sequence mtr-MIR2590b

AccessionMI0011809 (change log)
DescriptionMedicago truncatula miR2590b stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590b
(1 sentences)

Stem-loop
   ag    u                  g          c   a      -  aagaaauauucaugaaauuaauguuaaccaauaaaaucucagccugaccgga 
5'   aaaa uucaagaaugacauggca aauaaucacc uua auuuua uc                                                    a
     |||| |||||||||||||||||| |||||||||| ||| |||||| ||                                                     
3'   uuuu aaguucuuacuguaccgu uuauuagugg aau uaaagu ag                                                    a
   --    u                  g          a   c      c  aguaaauaauuagaaaguauuuuuuucuauguauuguggguggugggguacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 31149740-31149942 [+]
intergenic
Database links

Mature sequence mtr-miR2590b

Accession MIMAT0013262
Sequence

163 - 

aucuaaaggugauuauugugcc

 - 184

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).