Stem-loop sequence mtr-MIR2590d

AccessionMI0011811 (change log)
DescriptionMedicago truncatula miR2590d stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590d
(1 sentences)

Stem-loop
   c    aaau                  g          c         aucaagaaauagucuugaaacuaauguuagccaauaaaaucucagccuggucgga 
5'  aaga    uucaagaaugacauggca aauaaucacc uuagauuuu                                                       a
    ||||    |||||||||||||||||| |||||||||| |||||||||                                                        
3'  uucu    aaguucuuacuguaccgu uuauuagugg aaucuaaag                                                       a
   u    ----                  g          a         ucagaguaaauaauuagaaaguauuuuuuuuuauguauugugggugguggguacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 7888321-7888524 [+]
intergenic
Database links

Mature sequence mtr-miR2590d

Accession MIMAT0013264
Sequence

164 - 

aucuaaaggugauuauugugcc

 - 185

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).