Stem-loop sequence mtr-MIR2590e

AccessionMI0011812 (change log)
DescriptionMedicago truncatula miR2590e stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590e
(1 sentences)

Stem-loop
   u    aaau                  g          c         aucaagaaauaguccugaaauuaauguuagccaauaaaaucucagucuggccggaaa 
5'  aaga    uuuaagaaugacauggca aauaaucacc uuagauuuu                                                         u
    ||||    |||||||||||||||||| |||||||||| |||||||||                                                         c
3'  uucu    aaguucuuacuguaccgu uuauuagugg aaucuaaag                                                         a
   u    ----                  g          a         uuagaguaaauaauuagaaaguauuuuuauuuuuuuuauguauuguggguggugggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 27285345-27285553 [+]
intergenic
Database links

Mature sequence mtr-miR2590e

Accession MIMAT0013265
Sequence

169 - 

aucuaaaggugauuauugugcc

 - 190

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).