Stem-loop sequence mtr-MIR2590f

AccessionMI0011813 (change log)
DescriptionMedicago truncatula miR2590f stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590f
(1 sentences)

   aaaau                  g          c          ucaagaaauagucuugaaauuaauguuagccaauaaaaucucagccgaaaau 
5'      uuuaagaaugacauggca aauaaucacc uuagauuuua                                                    c
        |||||||||||||||||| |||||||||| ||||||||||                                                    a
3'      aaguucuuacuguaccgu uuauuagugg aaucuaaagu                                                    u
   uuuau                  g          a          cagaguaaauaauuagaaaguauuuuuuuuuuauguauugugggugguggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC199470.3: 30990-31186 [-]
Database links

Mature sequence mtr-miR2590f

Accession MIMAT0013266

157 - 


 - 178

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).