Stem-loop sequence mtr-MIR2591

AccessionMI0011814 (change log)
DescriptionMedicago truncatula miR2591 stem-loop
Stem-loop
   a      c     c         gcaaauuaa       c     u uuacuucaaaaauuuauaaauuaacuaucauuuuuaugaaauaaaaagcuauuuguugauaucuauauuuuagaaaauaucauuucauaagaaaaaaagcaucauuucauuguuuauaaaaaucauacuaauuuuuuuagauuuauuguaaaaaaua 
5'  agggaa uucua gguacaccu         gguguau gguac c                                                                                                                                                             a
    |||||| ||||| |||||||||         ||||||| ||||| |                                                                                                                                                              
3'  uccuuu aagau ccauguggg         ucacaua ccaug g                                                                                                                                                             u
   a      u     a         uuucuauac       a     u auuuaguaauuuaaucaucaauuuacacaauaaaaaauuucucuuuuuaacaaaagauaguggauauuaauauuauuaauuuagaauaaauaguuuuuguagcugcuuuauuuuaaacuaaaaagacuuaaaaaucaugagcauuaucucuuaaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 14541103-14541512 [-]
intergenic
Database links

Mature sequence mtr-miR2591

Accession MIMAT0013267
Sequence

4 - 

ggaacuucuacgguacaccugc

 - 25

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).