Stem-loop sequence mtr-MIR2592d

AccessionMI0011817 (change log)
DescriptionMedicago truncatula miR2592d stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592d
(2 sentences)

Stem-loop
   a     -           c                         -               cu            u           uau   - g         a    -          -a      a 
5'  gguaa uucaaacuugu aaacaacaggacucaagcauuucgc aagcgccucauguuu  ccuuugaaaaua uaaauuuuugu   gcu g uuuagauga ggua uuaaguguca  ggauug a
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||  |||||||||||| |||||||||||   ||| | ||||||||| |||| ||||||||||  |||||| c
3'  cuauu aaguuuggacg uuuguuguccugaguucguaaagcg uuuguggaguacaaa  ggaaacuuuuau auuuaaaaaca   cga c aaaucuacu ccau aguucacggu  cuuaac c
   -     u           u                         g               ag            u           cuc   a g         a    g          gg      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 29660782-29661036 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592d
mtr-MIR2592dchr3: 29660782-29661036 [-]
mtr-MIR2592echr3: 29660779-29661036 [+]
Database links

Mature sequence mtr-miR2592d-5p

Accession MIMAT0020941
Previous IDsmtr-miR2592d*
Sequence

22 - 

caacaggacucaagcauuucgc

 - 43

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR2592d-3p

Accession MIMAT0013270
Previous IDsmtr-miR2592d
Sequence

216 - 

aaaugcuugaguccuguuguu

 - 236

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).