Stem-loop sequence mtr-MIR2592e

AccessionMI0011818 (change log)
DescriptionMedicago truncatula miR2592e stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592e
(2 sentences)

Stem-loop
   u   aua         c  ca                         c  a a          uc            a           gag   u c         u    cuc     ccaccgaa ug   uu 
5'  ggg   aauucaaac ug  aaacaacaggacucaagcauuucgc aa c ccucauguuu  ccuuugaaaaua uaaauuuuugu   gcu g uuuagauga ggua   aagug        u  agg  c
    |||   ||||||||| ||  ||||||||||||||||||||||||| || | ||||||||||  |||||||||||| |||||||||||   ||| | ||||||||| ||||   |||||        |  |||   
3'  ucc   uuaaguuug ac  uuuguuguccugaguucguaaagcg uu g ggaguacaaa  ggaaacuuuuau auuuaaaaaca   cga c aaaucuacu ccau   uucac        a  ucc  a
   -   --a         a  ag                         -  c c          ga            a           aua   c -         u    -aa     -------- gu   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 29660779-29661036 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592e
mtr-MIR2592echr3: 29660779-29661036 [+]
mtr-MIR2592dchr3: 29660782-29661036 [-]
Database links

Mature sequence mtr-miR2592e-5p

Accession MIMAT0020942
Previous IDsmtr-miR2592e*
Sequence

25 - 

caacaggacucaagcauuucgc

 - 46

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR2592e-3p

Accession MIMAT0013271
Previous IDsmtr-miR2592e
Sequence

219 - 

aaaugcuugaguccuguuguu

 - 239

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).