Stem-loop sequence mtr-MIR2592j

AccessionMI0011821 (change log)
DescriptionMedicago truncatula miR2592j stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592j
(2 sentences)

Stem-loop
   a         c  ca                         c  a            uc     a      a           gag   u c         u      c     ccaccgaa ug   uu 
5'  aauucaaac ug  aaacaacaggacucaagcauuucgc aa caccucauguuu  ccuuu aaaaua uaaauuuuugu   gcu g uuuagauga gguauu aagug        u  agg  c
    ||||||||| ||  ||||||||||||||||||||||||| || ||||||||||||  ||||| |||||| |||||||||||   ||| | ||||||||| |||||| |||||        |  |||   
3'  uuaaguuug ac  uuuguuguccugaguucguaaagcg uu guggaguacaaa  ggaaa uuuuau auuuaaaaaca   cga c aaaucuacu ccauaa uucac        a  ucc  a
   a         a  ag                         -  c            ga     c      a           aua   c -         u      -     -------- gu   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 18620902-18621150 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592j
mtr-MIR1510bchr5: 18612353-18612588 [+]
mtr-MIR1510achr5: 18616293-18616456 [+]
mtr-MIR2592jchr5: 18620902-18621150 [+]
mtr-MIR2089chr5: 18629430-18629592 [+]
Database links

Mature sequence mtr-miR2592j

Accession MIMAT0013274
Sequence

213 - 

aaaugcuugaguccuguuguu

 - 233

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).