Stem-loop sequence mtr-MIR2592p

AccessionMI0011823 (change log)
DescriptionMedicago truncatula miR2592p stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592p
(2 sentences)

Stem-loop
   gggcu             c                         -               cu            u           uau        -a     au    -         -a      a 
5'      aauucaaacuugu aaacaacaggacucaagcauuucgc aagcgccucauguuu  ccuuugaaagua uaaauuuuugu   gcugguuu  gauga  guau uaaguguca  ggauug a
        ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||  |||||||||||| |||||||||||   ||||||||  |||||  |||| |||||||||  |||||| c
3'      uuaaguuuggacg uuuguuguccugaguucguaaagcg uuuguggaguacaaa  ggaaacuuuuau auuuaaagaca   cgaucgaa  cuacu  caua guucacggu  cuuaac c
   -cuau             u                         g               ag            u           cuc        ac     ac    a         gg      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 47247439-47247694 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592p
mtr-MIR2592pchr4: 47247439-47247694 [+]
mtr-MIR2592qchr4: 47247440-47247696 [-]
Database links

Mature sequence mtr-miR2592p

Accession MIMAT0013276
Sequence

217 - 

aaaugcuugaguccuguuguu

 - 237

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).