Stem-loop sequence mtr-MIR2592q

AccessionMI0011824 (change log)
DescriptionMedicago truncatula miR2592q stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592q
(2 sentences)

Stem-loop
   g  aua         c  ca                         c  a a          uc         a  a       c   gag   a c         ug     c     ccaccgaa ug   uu 
5'  gg   aauucaaac ug  aaacaacaggacucaagcauuucgc aa c ccucauguuu  ccuuugaaa ua uaaauuu ugu   gcu g uuuggauga  guauu aagug        u  agg  c
    ||   ||||||||| ||  ||||||||||||||||||||||||| || | ||||||||||  ||||||||| || ||||||| |||   ||| | |||||||||  ||||| |||||        |  |||   
3'  cc   uuaaguuug ac  uuuguuguccugaguucguaaagcg uu g ggaguacaaa  ggaaacuuu au auuuaaa aca   cga c aaaucuacu  cauaa uucac        a  ucc  a
   -  -ga         a  ag                         -  c c          ga         c  a       a   aua   c -         ua     -     -------- gu   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 47247440-47247696 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592q
mtr-MIR2592qchr4: 47247440-47247696 [-]
mtr-MIR2592pchr4: 47247439-47247694 [+]
Database links

Mature sequence mtr-miR2592q-5p

Accession MIMAT0020944
Previous IDsmtr-miR2592q*
Sequence

24 - 

caacaggacucaagcauuucgc

 - 45

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR2592q-3p

Accession MIMAT0013277
Previous IDsmtr-miR2592q
Sequence

218 - 

aaaugcuugaguccuguuguu

 - 238

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).