Stem-loop sequence mtr-MIR2592s

AccessionMI0011826 (change log)
DescriptionMedicago truncatula miR2592s stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592s
(2 sentences)

Stem-loop
   a                          g                   a            -            a                 u c         u a    c     a   c   a  a 
5'  gauaaauucaaaccugucaaacaaca gacucaagcauuucgcucg cguucauguuuu ccuuugaaaaga uaaauuuuuguuaggcu g uuuagauga g uauu aagug caa gaa ug g
    |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||| | ||||||||| | |||| ||||| ||| ||| || g
3'  cuauuuaaguuuggacgguuuguugu cugaguucguaaagcgagc guaaguacaaaa ggaaacuuuucu auuuaaaaacaauccga c aaaucuacu c auaa uucac guu cuu ac u
   -                          a                   c            a            a                 c -         u c    -     a   c   -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 18079450-18079703 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592s
mtr-MIR2592schr6: 18079450-18079703 [+]
mtr-MIR2592bcchr6: 18079525-18079628 [-]
Database links

Mature sequence mtr-miR2592s-5p

Accession MIMAT0026925
Sequence

22 - 

acaacaggacucaagcauuuc

 - 42

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR2592s-3p

Accession MIMAT0013279
Sequence

215 - 

aaaugcuugagucauguuguu

 - 235

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).