Stem-loop sequence mtr-MIR2593a

AccessionMI0011827 (change log)
DescriptionMedicago truncatula miR2593a stem-loop
Gene family MIPF0000875; MIR2593
Stem-loop
   u            -u           a                  caca      uu 
5'  uauaagcaaaaa  uuacauuuuag uucauucauuuaaugaug    uggucu  a
    ||||||||||||  ||||||||||| ||||||||||||||||||    ||||||  u
3'  auauucguuuuu  gauguaagauc aaguaaguaaauuacuac    accaga  u
   u            uu           c                  auac      ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 46167544-46167659 [+]
intergenic
Database links

Mature sequence mtr-miR2593a

Accession MIMAT0013280
Sequence

77 - 

uuaaaugaaugaaccuagaau

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).