Stem-loop sequence mtr-MIR2593b

AccessionMI0011828 (change log)
DescriptionMedicago truncatula miR2593b stem-loop
Gene family MIPF0000875; MIR2593
Stem-loop
   u            u   c       a                  caca      uu 
5'  uauaagcaaaag uua auuuuag uucauucauuuaaugaug    uggucu  a
    |||||||||||| ||| ||||||| ||||||||||||||||||    ||||||  u
3'  auauucguuuuu gau uaagauc aaguaaguaaauuacuac    accaga  u
   u            u   a       c                  auac      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 26182057-26182171 [-]
intergenic
Database links

Mature sequence mtr-miR2593b

Accession MIMAT0013281
Sequence

77 - 

uuaaaugaaugaaccuagaau

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).