Stem-loop sequence mtr-MIR2594

AccessionMI0011830 (change log)
DescriptionMedicago truncatula miR2594 stem-loop
Stem-loop
   -ccgcuucuc      g   uagu     c   g   uug 
5'           agugcu cug    uccuu ggc aug   c
             |||||| |||    ||||| ||| |||    
3'           ucacgg gac    aggaa ccg uac   u
   ugccucaucu      a   -cgu     -   g   cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 19673181-19673259 [+]
intergenic
Database links

Mature sequence mtr-miR2594

Accession MIMAT0013283
Sequence

44 - 

ccauggccaaggaugccagag

 - 64

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).