Stem-loop sequence mtr-MIR2595

AccessionMI0011832 (change log)
DescriptionMedicago truncatula miR2595 stem-loop
Stem-loop
   aguu         -a                 u        u         caguucuaauuuuauagcu 
5'     uuugcaauu  uaaaagagauauagaga gagaaugu acaagucug                   a
       |||||||||  ||||||||||||||||| |||||||| |||||||||                   g
3'     ggacguuaa  auuuucucuguauuucu cuuuuaca uguuuagac                   u
   --gc         aa                 u        u         auucagacaauaccuguuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 10658083-10658222 [+]
intergenic
Database links

Mature sequence mtr-miR2595

Accession MIMAT0013285
Sequence

101 - 

uacauuuucuucuuuaugucu

 - 121

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).