Stem-loop sequence mtr-MIR2596

AccessionMI0011833 (change log)
DescriptionMedicago truncatula miR2596 stem-loop
Stem-loop
   g        -              u       u          uuucu 
5'  uuggguug caaaagggaucuau ucauugu ccacacauuu     u
    |||||||| |||||||||||||| ||||||| ||||||||||      
3'  aacccaac guuuuuucuagaua aguaaua gguguguaaa     g
   a        u              u       -          uccaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 22399309-22399404 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2596
mtr-MIR5210chr3: 22394767-22394883 [+]
mtr-MIR2596chr3: 22399309-22399404 [+]
Database links

Mature sequence mtr-miR2596

Accession MIMAT0013286
Sequence

19 - 

ucuauuucauuguuccacaca

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).