Stem-loop sequence mtr-MIR2111c

AccessionMI0011836 (change log)
DescriptionMedicago truncatula miR2111c stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111c
(8 sentences)

Stem-loop
   -ag     -   c  -au              c            -   aucga 
5'    auugg gau ag   gagauaaucugcau cugagguuuaga aca     u
      ||||| ||| ||   |||||||||||||| |||||||||||| |||     g
3'    uaacc cua uc   cucuauuagacgua gauuccgaaucu ugu     c
   acg     a   u  cuu              a            a   caaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16686087-16686193 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111c
mtr-MIR2111bchr7: 16691057-16691162 [-]
mtr-MIR2111cchr7: 16686087-16686193 [-]
mtr-MIR2111dchr7: 16685914-16686016 [-]
mtr-MIR2111echr7: 16678770-16678875 [-]
Database links

Mature sequence mtr-miR2111c

Accession MIMAT0013289
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).