Dead miRNA entry

miRNA accession:
MI0011837
miRNA ID:
mtr-MIR2111i
Forward to:
MI0011836
Comment:
The MIR2111 loci in miRBase 19 overlap in the Mt3.5.2 genome assembly. The entries are rationalised and merged in miRBase 20, leading to several entries being renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR2111i

AccessionMI0011837 (change log)
DescriptionMedicago truncatula miR2111i stem-loop
Stem-loop
   c   auc          a             cu       ca      -caga     aauaaucu    a  uu  -   -   c 
5'  ugu   uaagccuuag augcagauuaucu  uccuuau  ccaaug     acuga        ugau gu  cc auu uuc a
    |||   |||||||||| |||||||||||||  |||||||  ||||||     |||||        |||| ||  || ||| ||| a
3'  acg   auuuggaguc uacgucuaauaga  aggaaug  gguuau     uggcu        auua cg  gg uaa gag u
   a   -au          c             uu       --      aaaua     ---gaugu    c  cu  a   c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16649857-16649962 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111i
mtr-MIR2111hchr7: 16655725-16655830 [-]
mtr-MIR2111ichr7: 16649857-16649962 [-]
mtr-MIR2111jchr7: 16649192-16649293 [-]
mtr-MIR2111kchr7: 16644233-16644366 [-]
mtr-MIR2111lchr7: 16644069-16644155 [-]
Database links

Mature sequence mtr-miR2111i

Accession MIMAT0013290
Sequence

140 - 

auaaucugcauccugagguuu

 - 160

Get sequence
Evidence experimental;