Stem-loop sequence mtr-MIR2111d

AccessionMI0011838 (change log)
DescriptionMedicago truncatula miR2111d stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111d
(8 sentences)

Stem-loop
   a      --g      uua            c      u   u  -    au 
5'  uauugg   uaagga   gauaaucugcau cugagg uua ag caau  u
    ||||||   ||||||   |||||||||||| |||||| ||| || ||||   
3'  guaacc   auuccu   cuauuagacgua gauucc aau uc guug  u
   g      gua      uuc            a      u   u  u    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2111d-5p

Accession MIMAT0013291
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence mtr-miR2111d-3p

Accession MIMAT0026926
Sequence

64 - 

auccuuagaaugcagauuauc

 - 84

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).